Элементы Элементы большой науки

Поставить закладку

Напишите нам

Карта сайта

Содержание
Энциклопедия
Новости науки
LHC
Картинка дня
Библиотека
Методология науки
Избранное
Публичные лекции
Лекции для школьников
Библиотека «Династии»
Интервью
Опубликовано полностью
В популярных журналах
«В мире науки»
«Знание — сила»
«Квант»
«Квантик»
«Кот Шрёдингера»
«Наука и жизнь»
«Наука из первых рук»
«Популярная механика»
«Потенциал»: Химия. Биология. Медицина
«Потенциал»: Математика. Физика. Информатика
«Природа»
«Троицкий вариант»
«Химия и жизнь»
«Что нового...»
«Экология и жизнь»
Из Книжного клуба
Статьи наших друзей
Статьи лауреатов «Династии»
Выставка
Происхождение жизни
Видеотека
Книжный клуб
Задачи
Масштабы: времена
Детские вопросы
Плакаты
Научный календарь
Наука и право
ЖОБ
Наука в Рунете

Поиск

Подпишитесь на «Элементы»



ВКонтакте
в Твиттере
в Фейсбуке
на Youtube
в Instagram



Новости науки

 
08.12
Европейская мышь и рыжая полевка не обмениваются блохами

07.12
Мальки рыб в океане держатся родственными стайками

05.12
Хищные бактерии помогают иммунной системе справиться с инфекцией

01.12
Иммунный статус макак зависит от социального

29.11
Муравьи способны узнавать себя в зеркале






Главная / Библиотека / В популярных журналах / «Популярная механика» версия для печати

Сыновья Адама

Александр Чубенко,
интернет-журнал «Коммерческая биотехнология»
«Популярная механика» №10, 2007

Изображение: «Популярная механика»

С помощью меток, оставленных случайными мутациями на Y-хромосоме, вы можете проследить свою родословную по мужской линии вплоть до Адама. Правда, не библейского.

Вопрос «откуда есть пошла?..» для целых племен и народов до недавнего времени решался с помощью данных истории, археологии, лингвистики и других не очень точных наук. Определить свою личную родословную любой человек мог с помощью архивов ЗАГСов, ревизских сказок, церковноприходских книг — на три, пять, хорошо если на 10–15 поколений.

Сейчас любой из нас может определить свою родословную до прародителей человечества. Правда, не библейских, а молекулярно-генетических — «митохондриальной Евы» и «Y-хромосомного Адама». К ним, жившим в Юго-Восточной Африке (по самым общепринятым из условных и приблизительных оценок — 150–170 или 60–80 тысяч лет назад), сходятся ветви генеалогического древа каждого из живущих на Земле 6,6 млрд человек. За прошедшие века в нашей ДНК, как визы в паспорте, добавились пометки о путях, по которым потомки Адама разбрелись по миру.

Карта миграций человечества по данным Y-хромосом. Изображение: «Популярная механика»
Карта миграций человечества по данным Y-хромосом. Изображение: «Популярная механика»

Какой народ каким путем добрался до нынешнего места жительства за тысячелетия великих и незаметных переселений, завоеваний, объединений и смешений? Как носило по свету лично ваших предков с тех пор, как они покинули колыбель народов — Африку? И от какой из групп этих переселенцев вы происходите — отдельно по отцовской и материнской линии? Сколько поколений назад жил ближайший предок, от которого по прямой линии произошли лично вы и кто-нибудь из ныне царствующих особ? На все эти вопросы может ответить анализ ДНК.

Генографический проект

Ученые восстановили приблизительную картину расселения народностей по миру до европейской экспансии, начавшейся после 1500 года н.э. Изображение: «Популярная механика»
Ученые восстановили приблизительную картину расселения народностей по миру до европейской экспансии, начавшейся после 1500 года н.э. Изображение: «Популярная механика»

Изучать этногеномику начали в 1980-х годах, когда компьютеры еще не обладали таким быстродействием, а методы анализа ДНК были на несколько порядков медленнее и дороже нынешних. Сейчас самый простой, но достаточно полный анализ индивидуальной молекулярной генеалогии, по 12 маркерам Y-хромосомы, стоит $100–150, а более чем достаточный, по 37 маркерам Y-ДНК + полный тест митохондриальной ДНК, — около $400. Базы данных на десятки тысяч образцов ДНК есть у ряда коммерческих фирм и общественных институтов, и большинство из них (с определенными ограничениями на допуск к персональной информации) открыты для всех. За счет интереса людей к своим индивидуальным родословным информация в этих базах накапливается быстрее, чем ученые успевают ее обработать. Самое грандиозное из исследований целых популяций — Genographic Project («Генографический проект»), начатый в 2005 году Национальным географическим обществом США (National Geographic Society) при поддержке компании IBM. Цель проекта — за пять лет собрать не менее 100 000 образцов ДНК типичных представителей народов или племен, история которых известна по данным этнографии, истории и археологии, чтобы уточнить пути миграций человечества по Земле. На самом деле и такая огромная выборка — капля в море по сравнению с реальным разнообразием рас и племен, но по мере добавления информации результаты можно будет уточнять. Даже черновой план, составленный участниками проекта под руководством доктора Спенсера Уэллса, — захватывающее зрелище, особенно в виде интерактивной карты на сайте проекта. Но для начала разберемся с терминами.

Молекулярная генеалогия

При образовании половых клеток из диплоидных клеток-предшественников их соматические хромосомы (а у женщин — и половые) обмениваются участками — примерно так, как происходит, если не слишком тщательно перетасовать две колоды карт с рубашками разного цвета и снова разложить их на два одинаковых набора независимо от цвета рубашек. По четверти генома мы получаем от каждого из двух дедушек и двух бабушек, 1/8 — от прадедов и прабабок... В наших хромосомах есть гены не только Адама и Евы, но и всех их близких и дальних родственников, живших 70–80 тысяч лет назад, когда численность нашего вида снизилась до критической величины — примерно 10 000 особей, и более далеких предков, вплоть до первых млекопитающих и даже первых многоклеточных животных. Но от них мы получили только соматические и X-хромосомы, гены которых в результате постоянного перемешивания расплываются по всей популяции. Почти неизменными из поколения в поколение переходят только Y-хромосома и митохондриальная ДНК. На этом «почти» и основана вся молекулярная генеалогия, изучающая историю по мутациям, произошедшим у предков и сохранившимся в ДНК потомков.

Мутации: полезные, вредные и нейтральные

Обычно крупные мутации — например, перемещение на другое место, удвоение или, наоборот, выпадение крупного участка хромосомы, несущего один или несколько генов, — не приводят ни к чему хорошему. Как, впрочем, и часто встречающиеся одиночные нуклеотидные полиморфизмы — SNP, если они происходят в пределах одного из 21 000 человеческих генов.

В ядре каждой человеческой клетки, кроме яйцеклеток и сперматозоидов, содержится диплоидный (двойной) набор из 46 хромосом: 22 пары соматических («телесных») и пара половых: XX у женщин и XY у мужчин. В половых клетках набор хромосом гаплоидный – одиночный (без греческих терминов тут не обойтись: хромосомная генеалогия основана на определении индивидуальных гаплотипов, относящихся к разным гаплогруппам). Изображение: «Популярная механика»
В ядре каждой человеческой клетки, кроме яйцеклеток и сперматозоидов, содержится диплоидный (двойной) набор из 46 хромосом: 22 пары соматических («телесных») и пара половых: XX у женщин и XY у мужчин. В половых клетках набор хромосом гаплоидный — одиночный (без греческих терминов тут не обойтись: хромосомная генеалогия основана на определении индивидуальных гаплотипов, относящихся к разным гаплогруппам). Изображение: «Популярная механика»

Полезные мутации происходят намного реже и сохраняются в последующих поколениях. Вредные — удаляются из популяции вместе с носителем или еще на стадии эмбриона, или, при тяжелой наследственной болезни, до того, как этот носитель успеет обзавестись потомством. В результате действия стабилизирующего отбора и происходивших время от времени снижений численности вида, уменьшающих его генетическое разнообразие, строение генов у двух выбранных наугад людей совпадает на 99,9%. Все наши отличия, от цвета кожи и разреза глаз до роста и склонности к определенным болезням, определяют в основном генные полиморфизмы — незначительные различия в нуклеотидных последовательностях практически одинаковых генов и, соответственно, в строении и функциях закодированных в этих генах белков.

Во-первых, случайные мутации происходят постоянно, и полиморфизмами считают те из них, которые произошли давно и поэтому встречаются чаще, чем у 1% людей в данной популяции (граница здесь условная — можно было бы считать случайными и варианты генов, встречающиеся реже, чем у 2–3%). Во-вторых, полиморфизмы не оказывают заметного влияния на здоровье их носителей или даже носят приспособительный характер. Правда, и здесь граница довольно размытая. Классический пример — SNP, обусловливающий у гомозигот — носителей двух мутантных генов — тяжелое наследственное заболевание, серповидноклеточную анемию. Но гетерозиготы по этому гену — носители здорового варианта на одной хромосоме и «испорченного» на другой — реже болеют малярией, а симптомы анемии испытывают только в экстремальных условиях, например в высокогорье. Эта мутация встречается на юге Индии, в Средиземноморье и у жителей Западной Африки и их потомков на других континентах.

При копировании хромосом «снипы» происходят с вероятностью 10–8 на один нуклеотид за поколение. При размере гаплоидного генома в 3 млрд (3 × 109) нуклеотидов за счет случайных точечных мутаций каждый ребенок имеет в среднем около 30 однонуклеотидных различий со своими родителями. По счастью, большинство таких мутаций приходится не на гены, а на так называемую мусорную ДНК — примерно 95% человеческого генома, не кодирующих ни белков, ни служебных РНК. Эти мутации ни на что не влияют, отбору они безразличны — вот они и сохраняются среди остального генетического «хлама». Именно их, а также короткие тандемные повторы (см. врезку) и используют в молекулярной генеалогии в качестве хромосомных маркеров — характерных особенностей.

Мальчики и девочки

Начнем с Адама: с мужской молекулярной генеалогией разобраться проще (впрочем, всё сказанное ниже о своем происхождении по мужской линии могут узнать и дамы — для этого нужно проанализировать ДНК отца, или брата, или дяди — любого прямого родственника по отцу).

Общепринятая классификация линий Y-хромосомы основана на последовательности появления на ней SNP-маркеров. На генеалогическом древе современных мужчин выделено 18 основных ветвей, обозначенных латинскими буквами, от первой ветки у самого корня – А до самой поздней – R. Эта классификация учитывает примерно 250 маркеров, по которым сейчас выделяют около 170 конечных «веток», каждая – со своим набором последовательно происходивших мутаций. По мере выявления новых маркеров к схеме добавляются новые ветви. Каждая из современных ветвей молекулярно-генеалогического древа отличается от Адама примерно двумя десятками разных мутаций в разных участках Y-хромосомы.  Изображение: «Популярная механика»
Общепринятая классификация линий Y-хромосомы основана на последовательности появления на ней SNP-маркеров. На генеалогическом древе современных мужчин выделено 18 основных ветвей, обозначенных латинскими буквами, от первой ветки у самого корня — А до самой поздней — R. Эта классификация учитывает примерно 250 маркеров, по которым сейчас выделяют около 170 конечных «веток», каждая — со своим набором последовательно происходивших мутаций. По мере выявления новых маркеров к схеме добавляются новые ветви. Каждая из современных ветвей молекулярно-генеалогического древа отличается от Адама примерно двумя десятками разных мутаций в разных участках Y-хромосомы. Изображение: «Популярная механика»

Примерно 300 млн лет назад у первых млекопитающих одна из хромосом, несущая среди прочих несколько генов, определяющих принадлежность к мужскому полу, начала терять остальные гены и вместе с ними — способность обмениваться участками ДНК с парной хромосомой. У человека на Y-хромосоме осталось всего 27 генов, большинство из них работают в семенниках. Остальная часть Y-хромосомной ДНК может пригодиться разве что для этнографии и генеалогии. Мутации — выпадения, замены или добавления одиночных нуклеотидов (SNP) и изменения числа повторений трех-четырех одинаковых нуклеотидов (STR) — происходят в разных участках Y-хромосомы с разной частотой, в среднем — одна мутация на каждые 500 поколений. В самых консервативных участках мутации случаются раз в 100 000 лет.

Y-хромосомный Адам жил примерно 80 000 лет назад, но «раз в 100 000 лет» — это вероятность мутации в этом участке хромосомы в непрерывном ряду поколений, и можно подсчитать, что даже такой редкий случай может произойти один раз в поколение примерно у одной из 3000 пар «отец–сын». Время и место жизни нашего общего прямого предка вычислили по анализу распределения в популяциях из разных регионов планеты Y-хромосомных маркеров. Их используют и для исследований в области этногеномики, и для выяснения индивидуальных генеалогий.

История и география

У населения старинных русских городов чаще всего встречаются гаплогруппы R1a, I1b и N. Очень условно их носителей можно назвать соответственно потомками восточных, южных и северных славян. На самом деле мутация, определяющая принадлежность к ветви R, предположительно появилась на северо-западе Азии 30–35 тысяч лет назад: в племени, все мужчины которого (или большинство из них) относились к более ранней гаплогруппе P, родился мальчик, в Y-хромосоме которого произошел сбой — замена всего одного нуклеотида, аденина на гуанин. Его потомки расселились по Европе и западной части Азии, по дороге смешиваясь с местными племенами, но у всех его прямых наследников сохранилась эта метка — маркер M207. Ее нашли и у мужчин одного из изолированных племен Камеруна — скорее всего, это потомки части доисторического племени, которая вернулась из Евразии в Африку.

Славянский базар

Подгруппа R1a (M17) зародилась в степях на территории нынешней Украины и юга России 10–15 тысяч лет назад. Племена известной по археологическим данным курганной культуры одними из первых приручили лошадь и за счет этого расселились чуть ли не по всему континенту, покорили туземцев, перемешались с ними и навязали им свой язык и религию, ставшие основой протоиндоевропейской (индоарийской) культуры. К прямым потомкам индоариев относятся 45% мужчин в высших кастах Индии, 40% поляков, северных русских, украинцев, белорусов, латышей и литовцев. Немного реже — южные и западные славяне, исландцы (Рюрик тоже был викингом), восточные немцы и народы России, язык которых относится к финно-угорской группе (тысячелетия соседства давно перемешали «русь, мордву и чудь»). Несмотря на все смешения племен, носители подгруппы R1a в южнорусских городах составляют 55% мужского населения, а в центральной России — до 70%. Но если кто-нибудь решит на основании принадлежности к этой подгруппе гордиться своей арийской кровью, напоминаем: ваши родственники живут и в пустыне Калахари, и далее по глобусу до Гренландии, Австралии и Огненной Земли. Кстати, среди казахов — во всем остальном типичных монголоидов — носителей подгруппы R1a не меньше, чем в России. Да, скифы мы...

У кого-то из пра-пра...правнуков родоначальника гаплогруппы R, двигавшихся понемногу на юг, 25 000 лет назад произошла еще одна мутация, M127. Ее носители, представители гаплогруппы R2, составляют 5–10% населения юга Центральной Азии, Пакистана и северной Индии. Еще одна ветвь этой группы повернула на запад, на земли, с которых сползал последний ледник. Подгруппа R1, у которой к предыдущим меткам на Y-хромосоме приблизительно 30 000 лет назад добавилась мутация M173, — самая распространенная в Европе и западной Евразии.

Этногеномика имеет дело с вероятностями мутаций, полученными путем приблизительных подсчетов, выборками из популяций и другими среднестатистическими величинами. Даже число тысячелетий в расчетах зависит от того, какое время смены поколений, от 20 до 35 лет, выберут авторы работы. Максимальное приближение во времени, которое показывает гаплогруппа даже с самым длинным буквенно-цифровым индексом, — это вероятность появления одного SNP, в лучшем случае 5000 лет, так что деталей индивидуальной генеалогии по ней не определить. Можно разве что спорить, родственниками в двухсотом или трехсотом колене приходятся друг другу больше трети жителей северной Индии, почти половина русских и почти треть норвежцев.

Генеалогия

А можно ли построить генеалогическое древо человека с более высокой точностью? Можно, но SNP для этого не подходят. Для детальных исследований в молекулярной генеалогии применяют короткие тандемные повторы — STR. При образовании сперматозоидов ферменты, копирующие ДНК клетки-предшественника, иногда пропускают или добавляют к такому тандему один из повторов. Если этот сперматозоид примет участие в рождении мальчика, все его сыновья, внуки и правнуки сохранят новую запись в этом маркере до тех пор, пока прямой род по мужской линии не оборвется — или до следующей мутации в том же STR. Повторная мутация может увеличить разницу в большую или меньшую сторону, сделав различия между ветвями древа более четкими, а может и восстановить исходное состояние. Но при использовании большого числа маркеров степень родства можно установить достаточно точно.

Ключи от генеалогического древа

ДНК представляет собой последовательность нуклеотидов, которые обозначаются буквами G (гуанин), T (тимин), A (аденин) и C (цитозин). Например, фрагмент ДНК может быть вот таким:
...GTACAAGAG(TAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA)CTGGTG...

Или вот таким:
...GTACAAGAG(TAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA)CTGGTG...

Обратите внимание на повторяющуюся комбинацию. Это и есть STR (short tandem repeat). Время от времени в «мусорной» части ДНК встречаются вот такие бессмысленные повторения трех-четырех нуклеотидов, в данном случае TAGA (тимин-аденин-гуанин-аденин). Это первый из наиболее часто используемых маркеров Y-хромосомы, DYS19 (DNA Y-chromosome Segment № 19), и приведенные для примера сочетания обозначаются как DYS19=14 и DYS19=15.

Теперь давайте посмотрим на другую последовательность:
...GTACTAGAG(TAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA)CTGGTG...

Изображение: «Популярная механика»

Это очень похоже на первую последовательность, но в пятом нуклеотиде произошла замена аденина на тимин. Это и есть SNP — одиночный нуклеотидный полиморфизм (single nucleotide polymorphism, «снип») Y-хромосомы. Ключевые «снипы» однозначно определяют гаплогруппу человека, то есть «ветвь» на дереве миграций человечества. Набор STR-маркеров Y-хромосомы определяет гаплотип человека. При сравнении гаплотипов двух человек можно (при совпадении гаплогруппы) приблизительно определить количество поколений до ближайшего общего предка по мужской линии.

У всех мужчин на Земле в локусах DYS19, 388, 390, 391, 392 и 393 есть тандемные повторы разной длины. Например, квадруплет TAGA (DYS19) может повторяться от 10 до 19 раз, триплет АТА (DYS388) — 10–16 раз и т. д. У 98% мужчин к базовому набору из шести общих маркеров, унаследованных от хромосомного Адама, добавился DYS385 — от 7 до 28 повторов «GAAA». У 34% есть еще DYS438 и 439 и т. д. В качестве генеалогических маркеров выбраны самые информативные из почти пятисот обнаруженных на Y-хромосоме STR. Стандартные ДНК-генеалогические тесты проводят по 12, 25, 37 или 67 маркерам, хотя уже шести часто достаточно для того, чтобы по комбинации числа повторов отнести «владельца» этого гаплотипа (индивидуального набора маркеров) к одной из гаплогрупп, от A до R. Например, так называемый «атлантический модальный гаплотип», наиболее распространенный на западе Европы, выглядит так: DYS19=14, DYS388=12, DYS390=24, DYS39=11, DYS392=13, DYS393=13. Человек с таким гаплотипом практически со стопроцентной вероятностью относится к гаплогруппе R1b или ее подвариантам.

Чем меньше расхождений в числе повторов нуклеотидных групп во всех проанализированных DYSах между двумя гаплотипами, тем больше вероятность того, что их носители — родственники. В тесте по 37 маркерам вероятность случайного совпадения всех из них — 1/637, 1 шанс из 6 × 1028 (население Земли, напомним, 6,6 × 109). Даже по 12 маркерам вероятность случайного совпадения — 1 шанс из двух с лишним миллиардов, и при полном совпадении чьих-нибудь DYS с вашим гаплотипом (и совпадении гаплогруппы) можно быть уверенным, что вы нашли брата, отца, дядю или «многоюродного» (но не более чем в десятом-пятнадцатом колене) родственника по прямой мужской линии. А что может быть в случае, если в такой базе вы найдете последовательность чисел, отличающуюся от вашей на 1, 2 или 5 единиц? Можно прикинуть, сколько поколений назад жил ваш ближайший общий предок. Расхождение на один повтор в любом из маркеров происходит в среднем один раз в 500 поколений, примерно раз в 15 000 лет. В гаплотипе из 37 маркеров одна мутация может произойти примерно раз в 13 поколений, или в 300–400 лет. Хотя средние частоты мутаций в различных DYS отличаются, они известны, так что можно еще немного уточнить возможное время расхождения. Правда, всё равно это будет всего лишь вероятность, но дальше уже можно будет покопаться в бумажных данных, от семейных архивов до летописей. И в любом случае вы узнаете много интересного, особенно если к информации об Y-хромосоме добавить анализ митохондриальной ДНК. Но о родстве по материнской линии читайте в следующих номерах.

Благодарим Анатолия Клёсова за помощь в написании статьи.
Материал подготовлен при содействии журнала National Geographic Россия.


Комментарии (1)


 


при поддержке фонда Дмитрия Зимина - Династия